|
Addgene inc
lentiviral vector plko 1 shrna control shctrl Lentiviral Vector Plko 1 Shrna Control Shctrl, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/lentiviral vector plko 1 shrna control shctrl/product/Addgene inc Average 96 stars, based on 1 article reviews
lentiviral vector plko 1 shrna control shctrl - by Bioz Stars,
2026-06
96/100 stars
|
Buy from Supplier |
|
Shanghai Genechem Ltd
retroviral vectors containing short hairpin rnas (shrnas) targeting mif and a shrna control (shctrl) Retroviral Vectors Containing Short Hairpin Rnas (Shrnas) Targeting Mif And A Shrna Control (Shctrl), supplied by Shanghai Genechem Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/retroviral vectors containing short hairpin rnas (shrnas) targeting mif and a shrna control (shctrl)/product/Shanghai Genechem Ltd Average 90 stars, based on 1 article reviews
retroviral vectors containing short hairpin rnas (shrnas) targeting mif and a shrna control (shctrl) - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
|
Genechem
control shrna vector shctrl Control Shrna Vector Shctrl, supplied by Genechem, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/control shrna vector shctrl/product/Genechem Average 86 stars, based on 1 article reviews
control shrna vector shctrl - by Bioz Stars,
2026-06
86/100 stars
|
Buy from Supplier |
|
OriGene
shctrl constructs Shctrl Constructs, supplied by OriGene, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/shctrl constructs/product/OriGene Average 96 stars, based on 1 article reviews
shctrl constructs - by Bioz Stars,
2026-06
96/100 stars
|
Buy from Supplier |
|
Genechem
shrna control (shctrl) vector Shrna Control (Shctrl) Vector, supplied by Genechem, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/shrna control (shctrl) vector/product/Genechem Average 90 stars, based on 1 article reviews
shrna control (shctrl) vector - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
|
Addgene inc
lentiviral vector shrna control shctrl Lentiviral Vector Shrna Control Shctrl, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/lentiviral vector shrna control shctrl/product/Addgene inc Average 96 stars, based on 1 article reviews
lentiviral vector shrna control shctrl - by Bioz Stars,
2026-06
96/100 stars
|
Buy from Supplier |
|
OriGene
gtacatctctagcagtgctggagccaggt origene tl309181c pgfp c shlenti scramble shctrl Gtacatctctagcagtgctggagccaggt Origene Tl309181c Pgfp C Shlenti Scramble Shctrl, supplied by OriGene, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/gtacatctctagcagtgctggagccaggt origene tl309181c pgfp c shlenti scramble shctrl/product/OriGene Average 96 stars, based on 1 article reviews
gtacatctctagcagtgctggagccaggt origene tl309181c pgfp c shlenti scramble shctrl - by Bioz Stars,
2026-06
96/100 stars
|
Buy from Supplier |
|
OriGene
shctrl Shctrl, supplied by OriGene, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/shctrl/product/OriGene Average 96 stars, based on 1 article reviews
shctrl - by Bioz Stars,
2026-06
96/100 stars
|
Buy from Supplier |